About   Help   FAQ
Cyp21a1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cyp21a1em1(IMPC)Tcp
Name: cytochrome P450, family 21, subfamily a, polypeptide 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156596
Gene: Cyp21a1  Location: Chr17:35020322-35023400 bp, - strand  Genetic Position: Chr17, 18.36 cM
Alliance: Cyp21a1em1(IMPC)Tcp page
IMPC: Cyp21a1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0692 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTAGCACCACCACATCTGAG and GGCCGACCCCATATGCTAAA targeting the 5' side and CAGATCGCTTCCTGGAACCT and GTGAGCGTCCTTGACAGGAT targeting the 3' side of a set of critical exons. This resulted in a 2104-bp deletion of Chr17 from 34802035 to 34804138 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cyp21a1 Mutation:  39 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory