Zc3h12c^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zc3h12c^em1(IMPC)Tcp
• Name: zinc finger CCCH type containing 12C; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156592
• Gene: Zc3h12c Location: Chr9:52022644-52079872 bp, - strand Genetic Position: Chr9, 28.62 cM
• Alliance: Zc3h12c^em1(IMPC)Tcp page
• IMPC: Zc3h12c gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0786 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTGCTAGGACAAGGCCGAGC and AGTGGGTGCGCCGACACCGC targeting the 5' side and AGGGCCTTGTCACTCTAGGG and CAATGGCAGTCATATAGACT targeting the 3' side of exon ENSMUSE00000535007. This resulted in a 760-bp deletion of Chr9 from 52126471 to 52127230 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zc3h12c Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)