Zfp629^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp629^em1(IMPC)Tcp
• Name: zinc finger protein 629; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156578
• Gene: Zfp629 Location: Chr7:127206203-127214969 bp, - strand Genetic Position: Chr7, 69.62 cM
• Alliance: Zfp629^em1(IMPC)Tcp page
• IMPC: Zfp629 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences CATAGGGGTCTGGTGATCTA, CGTGTCAGGACATCCACCAC, GAGGGTTCCCCACTGCCAAT, and GCGGAACTTGCTCATGGAAC that targeted exon(s) ENSMUSE00000709640.2 ENSMUSE00000748744.2 ENSMUSE00000781068.2 ENSMUSE00000788058.2 ENSMUSE00000792780.2. This resulted in deletion(s) of 3715 bp (location: Chr7:127207844-127211558; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp629 Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)