About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Alg6em1(IMPC)Tcp
Name: asparagine-linked glycosylation 6 (alpha-1,3,-glucosyltransferase); endonuclease mediated mutation 1, Toronto Centre for Phenogenomics
MGI ID: MGI:6156575
Gene: Alg6  Location: Chr4:99603901-99651697 bp, + strand  Genetic Position: Chr4, 45.71 cM
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 Protein and 4 guide sequences CCAGTTACATATTATGATCTAGG, GGACATTTGGAGTATCCAGACGG, CCAACTCAAAGCGGCAAGAGCAC, GGTCTTATTCTTATCGACTATGG, which resulted in a Exon Deletion. (J:237616)
View phenotypes and curated references for all genotypes (concatenated display).
In Structures Affected by this Mutation: 4 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alg6 Mutation:  21 strains or lines available
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.21
The Jackson Laboratory