Klf8em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Klf8em1(IMPC)Tcp |
| Name: |
Kruppel-like transcription factor 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:6156570 |
| Gene: |
Klf8 Location: ChrX:152020462-152179128 bp, + strand Genetic Position: ChrX, 68.46 cM
|
| Alliance: |
Klf8em1(IMPC)Tcp page
|
| IMPC: |
Klf8 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0860 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTAATACCAGTTCTTAACAA and TCTCTTTAGACTACCAACGG targeting the 5' side and AGACGGCAAAAGTGCTGGAT and TTCACCGTTTGCAATTTTGA targeting the 3' side leading to a 835-bp deletion from ChrX:153382333 to 153383167_insAAGTAGTGATAATAG (GRCm38).
(J:237616)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
2 reference(s) |
|