Mllt6^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mllt6^em1(IMPC)Tcp
• Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156510
• Gene: Mllt6 Location: Chr11:97554240-97576289 bp, + strand Genetic Position: Chr11, 61.05 cM
• Alliance: Mllt6^em1(IMPC)Tcp page
• IMPC: Mllt6 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0432 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCCTGTGACATTGCGTTTAC and CTGGACAGTACTGATCTGGA targeting the 5' side and GCCACGCCATGCTTAGGTCT and GGTAGGATGCTCCCACTCGG targeting the 3' side of exon ENSMUSE00001228124 (exon 5) resulting in a 316 bp deletion of Chr11 from 97666685 to 97667000, with a 19 bp insertion of GACGCCACGCCATGCTTAG.(GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mllt6 Mutation: 142 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)