About   Help   FAQ
Btnl4em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Btnl4em1(IMPC)Tcp
Name: butyrophilin-like 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156508
Gene: Btnl4  Location: Chr17:34687320-34696402 bp, - strand  Genetic Position: Chr17, 18.06 cM
Alliance: Btnl4em1(IMPC)Tcp page
IMPC: Btnl4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from projects TCPR0881 and TCPR0882 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and two guide RNAs with spacer sequences of GCAAGGAGTGTTCTATGATG targeting the 5' side and GGAGCATTCTGCAAGGCTGA targeting the 3' side of exons ENSMUSE00000141100 and ENSMUSE00000456939 resulting in a 1372-bp deletion of Chr17 from 34472676 to 34474047 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 131 and early truncation 10 amino acids later (p.Q131Hfs*12). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 3 strains available      Cell Lines: 0 lines available
Carrying any Btnl4 Mutation:  27 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory