Ccdc88b^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc88b^em1(IMPC)Tcp
• Name: coiled-coil domain containing 88B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156502
• Gene: Ccdc88b Location: Chr19:6821991-6835579 bp, - strand Genetic Position: Chr19, 5.08 cM
• Alliance: Ccdc88b^em1(IMPC)Tcp page
• IMPC: Ccdc88b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1049 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCCACCAGCTCTCCGGATTC and ATGCAGTTACGGAGCCTGAC targeting the 5' side and GCGCGCAGAGCTCTACCGCG and AGCGCCGCAGTTCTTCCTGC targeting the 3' side of a critical exon(s). This resulted in a 759-bp del Chr19: 6855420 to 6856178_insA (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc88b Mutation: 71 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)