About   Help   FAQ
Katnal2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Katnal2em1(IMPC)Tcp
Name: katanin p60 subunit A-like 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156497
Gene: Katnal2  Location: Chr18:77064844-77135004 bp, - strand  Genetic Position: Chr18, 52.02 cM, cytoband E3
Alliance: Katnal2em1(IMPC)Tcp page
IMPC: Katnal2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0845 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TAACGTTCCTTGCTGAAGAG and CTCTTTGTCGTGAGTCCCCT targeting the 5' side and GCTAAGAATGGCGTTCCCAG and TGAGCCTAGGAACACGGGAC targeting the 3' side leading to a 368-bp deletion from Chr18:77017405 to 77017772_insCCA (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Katnal2 Mutation:  199 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory