About   Help   FAQ
Kdm3bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Kdm3bem1(IMPC)Tcp
Name: KDM3B lysine (K)-specific demethylase 3B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156493
Gene: Kdm3b  Location: Chr18:34910100-34971713 bp, + strand  Genetic Position: Chr18, 18.73 cM, cytoband B3
Alliance: Kdm3bem1(IMPC)Tcp page
IMPC: Kdm3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1038 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTGATAGAGCTCATGTAGC targeting the 5' side and AGTTTACACGACAACAGACC targeting the 3' side of a critical exon. This resulted in a 812-bp del Chr18:34795059 to 34795870_insG (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kdm3b Mutation:  139 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory