Tagap1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tagap1^em1(IMPC)Tcp
• Name: T cell activation GTPase activating protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156489
• Gene: Tagap1 Location: Chr17:7222410-7228555 bp, - strand Genetic Position: Chr17, 4.55 cM, cytoband A1
• Alliance: Tagap1^em1(IMPC)Tcp page
• IMPC: Tagap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0851 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with two guide RNAs having spacer sequences of GGCGTGCTGAACCGCATCAA targeting the 5' side and TGACAGAATGCATTTCCACC targeting the 3' side of exons ENSMUSE00000658353, ENSMUSE00001018647, ENSMUSE00000975105, and ENSMUSE00000455244 resulting in a 5,812-bp deletion of Chr17 from 6955239 to 6961050 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 26 and early truncation 3 amino acids later (p.N26Kfs*5). (J:237616)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tagap1 Mutation: 19 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)