About   Help   FAQ
Rnf135em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Rnf135em1(IMPC)Tcp
Name: ring finger protein 135; endonuclease mediated mutation 1, Toronto Centre for Phenogenomics
MGI ID: MGI:6156488
Gene: Rnf135  Location: Chr11:80074677-80090583 bp, + strand  Genetic Position: Chr11, 47.59 cM, cytoband B5
Alliance: Rnf135em1(IMPC)Tcp page
IMPC: Rnf135 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA and 4 guide sequences TTCTGACTTGTGTACTCAGGGGG, TTGGAACAGGGCTCACACGTGGG, CCACTGATTGGGTGGGAATGGCC, TGATCCCTAATCCTAGTTTATGG, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 7 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rnf135 Mutation:  32 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/22/2022
MGI 6.22
The Jackson Laboratory