Plaat5^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plaat5^em1(IMPC)Tcp
• Name: phospholipase A and acyltransferase 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156474
• Gene: Plaat5 Location: Chr19:7589906-7617007 bp, + strand Genetic Position: Chr19, 5.33 cM, cytoband A
• Alliance: Plaat5^em1(IMPC)Tcp page
• IMPC: Plaat5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences ACAGTTCAACAGCTTCGCCC, ATATGGGCTAAATGTGCCTC, CTCAGAAGACCTTTATTAGG, and GTGCATGCCAGCACTCCCTA that targeted exon(s) ENSMUSE00000237794.2. This resulted in deletion(s) of 6 bp (location: Chr19:7591610-7591615; GRCm39), 8 bp (location: Chr19:7592297-7592304; GRCm39), and 435 bp (location: Chr19:7591715-7592149; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plaat5 Mutation: 24 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)