Pcm1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcm1^em1(IMPC)Tcp
• Name: pericentriolar material 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156455
• Gene: Pcm1 Location: Chr8:41692789-41785381 bp, + strand Genetic Position: Chr8, 23.89 cM
• Alliance: Pcm1^em1(IMPC)Tcp page
• IMPC: Pcm1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0971 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTGTCAGGTATTAGTATTGT targeting the 5' side and AGTGTAGCAACCTGCAAGCC and GTCTGTACGGTATGATAGCC targeting the 3' side of a critical region. This resulted in a 324-bp deletion Chr8:41267158 to 41267481 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pcm1 Mutation: 91 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)