Ptp4a2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptp4a2^em1(IMPC)Tcp
• Name: protein tyrosine phosphatase 4a2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156454
• Gene: Ptp4a2 Location: Chr4:129714262-129743796 bp, + strand Genetic Position: Chr4, 63.38 cM, cytoband D2.3
• Alliance: Ptp4a2^em1(IMPC)Tcp page
• IMPC: Ptp4a2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0995 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CACTTAAGTAAGTACCTGGT and TTAGCTAACATTGTCTGCCC targeting the 5' side and GCCAACTCAAATTTTTACCT and AGCTCTAATAAGAGCCCTTT targeting the 3' side leading to a 385-bp deletion from Chr4:129844869 to 129845253 (GRCm38). (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ptp4a2 Mutation: 76 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)