Fer^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fer^em1(IMPC)Tcp
• Name: FER tyrosine kinase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6156446
• Gene: Fer Location: Chr17:64170057-64446491 bp, + strand Genetic Position: Chr17, 33.06 cM
• Alliance: Fer^em1(IMPC)Tcp page
• IMPC: Fer gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1002 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) having spacer sequences of GTACCAGTCATGCTCCGCCA targeting the 5' side and CTGTATATTCTGACGGACAA targeting the 3' side leading to the a 140-bp del from Chr17:63981519 to 63981658. (GRCm38) (J:237616)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fer Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)