About   Help   FAQ
Aladem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Aladem1(IMPC)Tcp
Name: aminolevulinate, delta-, dehydratase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156441
Gene: Alad  Location: Chr4:62427406-62438155 bp, - strand  Genetic Position: Chr4, 33.17 cM
Alliance: Aladem1(IMPC)Tcp page
IMPC: Alad gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0629 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCCCGTGCCTGGGCAAGCCC and GGGCTATGGATTGATGGCTG targeting the 5' side and AATGTGATCCGGTGCTGAGA and TGCCTGAATTGGGGAGTTCG targeting the 3' side of exons ENSMUSE00001209877 and ENSMUSE00001244921 resulting in a 897-bp deletion of Chr4 from 62512719 to 62513615 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 19 and early truncation 19 amino acids later (p.D19Mfs*21). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alad Mutation:  24 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory