About   Help   FAQ
Foxr1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Foxr1em1(IMPC)Tcp
Name: forkhead box R1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156427
Gene: Foxr1  Location: Chr9:44345531-44352165 bp, - strand  Genetic Position: Chr9, 24.84 cM, cytoband B
Alliance: Foxr1em1(IMPC)Tcp page
IMPC: Foxr1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0944 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNA(s) having spacer sequences of GGCCAAGCCCGGGTAGTATG and TCCACTGTTACCCCATGATC targeting the 5' side and CCGCAAGCCATCAGCCCAGA and TGAGTGCCAAGGCAATCAGA targeting the 3' side leading to the a 976-bp deletion from Chr9:44435486 to 44436461 (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 4 assay results
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Foxr1 Mutation:  8 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory