About   Help   FAQ
Arid1bem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Arid1bem1(IMPC)Tcp
Name: AT-rich interaction domain 1B; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156423
Gene: Arid1b  Location: Chr17:5044607-5397931 bp, + strand  Genetic Position: Chr17, 2.83 cM
Alliance: Arid1bem1(IMPC)Tcp page
IMPC: Arid1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0317 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and single guide RNAs with spacer sequences of CTGCTTAGCAAGTTACCACT and GCCTGATACAGCACTTACAT targeting the 5' side and ACACTAAAGGGGTTGCTTTC and CTTGTAATCCCCCTGTAGTA targeting the 3' side of exon 5 (OTTMUSE00000314956) resulting in deletion of Chr17 from 5242523 to 5243410 with insertion of TT (GRCm38). (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 3 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arid1b Mutation:  109 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  7 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory