About   Help   FAQ
Kcnj11em1H
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnj11em1H
Name: potassium inwardly rectifying channel, subfamily J, member 11; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6156348
Synonyms: KCNJ11-E23K-EM1-B6N, Kcnj11-K23
Gene: Kcnj11  Location: Chr7:45746545-45750215 bp, - strand  Genetic Position: Chr7, 29.66 cM
Alliance: Kcnj11em1H page
IMPC: Kcnj11 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Single point mutation
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence targeting TACGGTACCTGGGCTCTGCAGGG, and a donor oligo. The engineered point mutation results in a change of amino acid 23 of the protein sequence from glutamic acid to lysine. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kcnj11 Mutation:  33 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory