Syt7em1(IMPC)H
Endonuclease-mediated Allele Detail
|
Symbol: |
Syt7em1(IMPC)H |
Name: |
synaptotagmin VII; endonuclease-mediated mutation 1, Harwell |
MGI ID: |
MGI:6156116 |
Gene: |
Syt7 Location: Chr19:10366454-10430544 bp, + strand Genetic Position: Chr19, 6.58 cM, cytoband B
|
Alliance: |
Syt7em1(IMPC)H page
|
IMPC: |
Syt7 gene page |
|
|
Allele Type: |
|
Endonuclease-mediated (Conditional ready) |
Mutation: |
|
Insertion
|
|
|
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 3 guide sequences CCTGTAAACTATATCATCCACGG, GGGGGAGACTGTTACAGGCTAGG, TTGAGGGGGGAGACTGTTACAGG, and a donor oligo, which resulted in a Conditional Ready allele.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Syt7 Mutation: |
38 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
2 reference(s) |
|