Ikzf2^em4(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ikzf2^em4(IMPC)H
• Name: IKAROS family zinc finger 2; endonuclease-mediated mutation 4, Harwell
• MGI ID: MGI:6156114
• Gene: Ikzf2 Location: Chr1:69570373-69726404 bp, - strand Genetic Position: Chr1, 34.9 cM
• Alliance: Ikzf2^em4(IMPC)H page
• IMPC: Ikzf2 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 4 guide sequences CCTTAGGTAGGCAAAGACTGATC, CCTTTGGTGAGAGGGACGACAGC, ATCCAGGAAGTGGACTAAAATGG, GGAGTACTCTTGGTGAACAAAGG, and a donor oligo, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ikzf2 Mutation: 44 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)