Lats1^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lats1^em2(IMPC)H
• Name: large tumor suppressor; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6153874
• Gene: Lats1 Location: Chr10:7556978-7592224 bp, + strand Genetic Position: Chr10, 2.29 cM, cytoband A1
• Alliance: Lats1^em2(IMPC)H page
• IMPC: Lats1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and 4 guides with spacer sequences CTTTTGAGCTTCACGAGCGC, GCGCTCGTGAAGCTCAAAAG, and GTAGGCTCCAGTATTCTTGT that targeted exon(s) ENSMUSE00000503486.4 ENSMUSE00001858654.1 ENSMUSE00002140245.1. This resulted in deletion(s) of 1855 bp (location: Chr10:7577100-7578954; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lats1 Mutation: 55 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)