Ermn^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ermn^em1(IMPC)H
• Name: ermin, ERM-like protein; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6153851
• Gene: Ermn Location: Chr2:57935125-57942876 bp, - strand Genetic Position: Chr2, 32.99 cM, cytoband C2
• Alliance: Ermn^em1(IMPC)H page
• IMPC: Ermn gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and the guide sequence CCTGGTGAACAACGAAGAGGTTC, which resulted in a Indel. (J:237616)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Ermn Mutation: 13 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)