Lta4h^{em3(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lta4h^{em3(IMPC)Wtsi}
• Name: leukotriene A4 hydrolase; endonuclease-mediated mutation 3, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153774
• Gene: Lta4h Location: Chr10:93289273-93320737 bp, + strand Genetic Position: Chr10, 48.42 cM, cytoband C3
• Alliance: Lta4h^{em3(IMPC)Wtsi} page
• IMPC: Lta4h gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence CCCCGATGTAGCCTATTCCTCCA, and a donor oligo, which resulted in a Point Mutation allele. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Lta4h Mutation: 28 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)