Herc1^{em3(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Herc1^{em3(IMPC)Wtsi}
• Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1; endonuclease-mediated mutation 3, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153732
• Gene: Herc1 Location: Chr9:66257732-66416057 bp, + strand Genetic Position: Chr9, 35.86 cM, cytoband D
• Alliance: Herc1^{em3(IMPC)Wtsi} page
• IMPC: Herc1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 genome editing technology was used to generate a 191bp deletion that included exon 8 of the gene. This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCATGTATGTAGGCAAACTTGGC, TGTTAATGTCTTCTGCTATCAGG, CAACAGGGCAGGTAAGACGAAGG, TAAGAGTATTTCAGTGGACTAGG. (J:237616, J:332580)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Herc1 Mutation: 206 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)