About   Help   FAQ
Due to maintenance, access to MGI may be intermittent 8:00 AM ET Wed, September 18.
Nr0b1em2(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Nr0b1em2(IMPC)Wtsi
Name: nuclear receptor subfamily 0, group B, member 1; endonuclease mediated mutation 2, Wellcome Trust Sanger Insititute
MGI ID: MGI:6153726
Gene: Nr0b1  Location: ChrX:86191775-86195947 bp, + strand  Genetic Position: ChrX, 39.67 cM
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCCTTTGAGCTTTCGAGGTCATG, CTGCGCCCTTGTCCAAGAGGAGG, ATCAGGAATACCCTGTCAAGTGG, CCAGAAACTTGGCACTGGATTGG, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nr0b1 Mutation:  7 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/05/2019
MGI 6.14
The Jackson Laboratory