About   Help   FAQ
Timd5em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Timd5em1(IMPC)Wtsi
Name: T cell immunoglobulin and mucin domain containing 5; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6153350
Gene: Timd5  Location: Chr11:46415078-46428983 bp, + strand  Genetic Position: Chr11, 27.98 cM
Alliance: Timd5em1(IMPC)Wtsi page
IMPC: Timd5 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences ATTGAACAGGTCCAGCATAG, CAGGAGGACACGGACACGAG, GCACTAGAGGCAGGGTAACC, and GGTGTAATGCACCACTATGC that targeted exon(s) ENSMUSE00001078494.2. This resulted in deletion(s) of 881 bp (location: Chr11:46418893-46419773; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Timd5 Mutation:  20 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory