Akr1e1^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Akr1e1^{em1(IMPC)Wtsi}
• Name: aldo-keto reductase family 1, member E1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6153273
• Gene: Akr1e1 Location: Chr13:4641122-4659163 bp, - strand Genetic Position: Chr13, 2.57 cM
• Alliance: Akr1e1^{em1(IMPC)Wtsi} page
• IMPC: Akr1e1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA and 4 guide sequences CCTCCAACACTCAAATATCCGTT, CCGTTAGGATCCAGATTAGCACA, CCACAGTGTATCAACGTATTTCA, CCTCACCATCAATAGCTAGGTAC, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Akr1e1 Mutation: 17 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)