Sncaem2(IMPC)H
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sncaem2(IMPC)H |
| Name: |
synuclein, alpha; endonuclease-mediated mutation 2, Harwell |
| MGI ID: |
MGI:6152693 |
| Gene: |
Snca Location: Chr6:60708559-60806839 bp, - strand Genetic Position: Chr6, 29.15 cM
|
| Alliance: |
Sncaem2(IMPC)H page
|
| IMPC: |
Snca gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences ACACATAGCAACAAGTGAAT, ACCGCTTTCATGTAAATGGT, ACCTACCATTTACATGAAAG, and GGACACAAAACATTGCAGCC that targeted exon(s) ENSMUSE00000153921.4 ENSMUSE00000153922.4 ENSMUSE00000300668.7 ENSMUSE00000423893.6 ENSMUSE00000491093.3 ENSMUSE00000698708.5 ENSMUSE00000726242.2 ENSMUSE00000749690.2 ENSMUSE00000772495.2 ENSMUSE00000774865.2 ENSMUSE00000790080.2 ENSMUSE00000810822.2 ENSMUSE00000811395.2 ENSMUSE00000825006.2 ENSMUSE00000835498.2 ENSMUSE00000840411.2 ENSMUSE00000872607.2 ENSMUSE00001162055.2 ENSMUSE00001228541.2 ENSMUSE00001364616.2 ENSMUSE00001364841.2 ENSMUSE00001366709.2 ENSMUSE00001367325.2 ENSMUSE00001367812.2 ENSMUSE00001368073.2 ENSMUSE00001369300.2 ENSMUSE00001369454.2 ENSMUSE00001369871.2 ENSMUSE00001529040.1 ENSMUSE00001529041.1 ENSMUSE00001547442.1 ENSMUSE00001547444.1 ENSMUSE00001547445.1 ENSMUSE00001547446.1 ENSMUSE00001547448.1 ENSMUSE00001547449.1 ENSMUSE00001547450.1 ENSMUSE00001547451.1 ENSMUSE00001547453.1 ENSMUSE00001547454.1 ENSMUSE00001547455.1 ENSMUSE00001547456.1 ENSMUSE00001547457.1 ENSMUSE00001547458.1 ENSMUSE00001547950.1 ENSMUSE00001595956.1 ENSMUSE00001595957.1. This resulted in deletion(s) of 3 bp (location: Chr6:61385704-61385706; GRCm39), 593350 bp (location: Chr6:60792336-61385685; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
2 reference(s) |
|