About   Help   FAQ
Upf3aem1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Upf3aem1(IMPC)Mbp
Name: UPF3 regulator of nonsense transcripts homolog A (yeast); endonuclease mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152673
Gene: Upf3a  Location: Chr8:13785615-13799193 bp, + strand  Genetic Position: Chr8, 6.38 cM, cytoband A2
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences CCTCTGTACGAACAACAGATTTC, CCTTGGTACGTGGTCTGACACCC, GCCATTTCTTGAAAGCGTGGTGG, GGCGTATGGTCATGAATATCAGG, which resulted in a Inter-exdel deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structures
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Upf3a Mutation:  0 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
06/30/2020
MGI 6.15
The Jackson Laboratory