Shisa8^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shisa8^em1(IMPC)Mbp
• Name: shisa family member 8; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6152639
• Gene: Shisa8 Location: Chr15:82091153-82097004 bp, - strand Genetic Position: Chr15, Syntenic
• Alliance: Shisa8^em1(IMPC)Mbp page
• IMPC: Shisa8 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences CCTCCAGCTAGCCAACTCTCCCA, CCACCGAGGGCTTGTCCAGACCC, CCCCGGACTATAAGATTATCTTC, GACATAAGAGTCTTAGAATGGGG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Shisa8 Mutation: 8 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)