About   Help   FAQ
Sgk2em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Sgk2em1(IMPC)Mbp
Name: serum/glucocorticoid regulated kinase 2; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6152636
Gene: Sgk2  Location: Chr2:162829250-162856047 bp, + strand  Genetic Position: Chr2, 83.93 cM, cytoband H3
Alliance: Sgk2em1(IMPC)Mbp page
IMPC: Sgk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davis by injecting CAS9 RNA and 4 guide sequences GTGAAGAGAGATTTAGCTGGGGG, CCACCCTGGCTACCTGTAAGACC, CCTCTTCCCTACGGCCACTCAGC, CCCCAAACATCTGCACTGTCAGC, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sgk2 Mutation:  27 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory