Sis^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sis^em1(IMPC)J
• Name: sucrase isomaltase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6151414
• Synonyms: Sis-KO
• Gene: Sis Location: Chr3:72795890-72875196 bp, - strand Genetic Position: Chr3, 32.59 cM
• Alliance: Sis^em1(IMPC)J page
• IMPC: Sis gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCAACTTAGAACATGTATT, CATGTATTGGGCTATCATGG, ATAGCTATCAAGTTCAGGTG and GCCCTAGTCATTGCTACAAA, which resulted in a 366 bp deletion beginning at Chromosome 3 position 72,960,985 bp and ending after 72,961,350 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000496008 (exon 4) and 248 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sis Mutation: 127 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)