Rr170tm3.1Iku
Targeted Allele Detail
|
|
| Symbol: |
Rr170tm3.1Iku |
| Name: |
regulatory region 170; targeted mutation 3.1, Koichi Ikuta |
| MGI ID: |
MGI:6151129 |
| Synonyms: |
Il7rCNS1.GRE1m, Il7rtm3.1Iku |
| Gene: |
Rr170 Location: Chr15:9533370-9533783 bp Genetic Position: Chr15, Syntenic
|
| Alliance: |
Rr170tm3.1Iku page
|
|
|
|
| Allele Type: |
|
Targeted (Modified regulatory region) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Mice harboring point mutations in one of the two glucocorticoid response elements (GREs) in the Il7r enhancer (upstream of the gene) were generated. The sequence mutated is in the first element (GRE1) as follows: GRE1 wild-type, CTTTGTTCTTTTACATCTTCA; GRE1m, CTTcacTgcTTTgagTgcTCA. A targeting construct containing the mutations and a loxP site flanked neomycin selection cassette was used to create mutant ES cells via homologous recombination. The neo cassette was removed through subsequent cre-mediated recombination.
(J:260412)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr170 Mutation: |
0 strains or lines available
|
|
| Original: |
J:260412 Shimba A, et al., Glucocorticoids Drive Diurnal Oscillations in T Cell Distribution and Responses by Inducing Interleukin-7 Receptor and CXCR4. Immunity. 2018 Feb 20;48(2):286-298.e6 |
| All: |
1 reference(s) |
|