About   Help   FAQ
Rr170tm3.1Iku
Targeted Allele Detail
Summary
Symbol: Rr170tm3.1Iku
Name: regulatory region 170; targeted mutation 3.1, Koichi Ikuta
MGI ID: MGI:6151129
Synonyms: Il7rCNS1.GRE1m, Il7rtm3.1Iku
Gene: Rr170  Location: Chr15:9533370-9533783 bp  Genetic Position: Chr15, Syntenic
Alliance: Rr170tm3.1Iku page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:260412
Parent Cell Line:  KY1.1 (ES Cell)
Strain of Origin:  (C57BL/6J x 129S6/SvEvTac)F1
Mutation
description
Allele Type:    Targeted (Modified regulatory region)
Mutation:    Single point mutation
 
Mutation detailsMice harboring point mutations in one of the two glucocorticoid response elements (GREs) in the Il7r enhancer (upstream of the gene) were generated. The sequence mutated is in the first element (GRE1) as follows: GRE1 wild-type, CTTTGTTCTTTTACATCTTCA; GRE1m, CTTcacTgcTTTgagTgcTCA. A targeting construct containing the mutations and a loxP site flanked neomycin selection cassette was used to create mutant ES cells via homologous recombination. The neo cassette was removed through subsequent cre-mediated recombination. (J:260412)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr170 Mutation:  0 strains or lines available
References
Original:  J:260412 Shimba A, et al., Glucocorticoids Drive Diurnal Oscillations in T Cell Distribution and Responses by Inducing Interleukin-7 Receptor and CXCR4. Immunity. 2018 Feb 20;48(2):286-298.e6
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory