Arl15^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arl15^em1(IMPC)H
• Name: ADP-ribosylation factor-like 15; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6149188
• Gene: Arl15 Location: Chr13:113931041-114293997 bp, + strand Genetic Position: Chr13, 64.02 cM
• Alliance: Arl15^em1(IMPC)H page
• IMPC: Arl15 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Insertion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and the guide sequence CCTGCGCGCCCTGAATATGACTT, which resulted in a Indel. (J:237616)

Expression

In Mice Carrying this Mutation:	24 assay results
In Structures Affected by this Mutation:	2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arl15 Mutation: 362 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 3 reference(s)