Atp9b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp9b^em1(IMPC)J
• Name: ATPase, class II, type 9B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6120511
• Gene: Atp9b Location: Chr18:80777356-80977275 bp, - strand Genetic Position: Chr18, 53.9 cM
• Alliance: Atp9b^em1(IMPC)J page
• IMPC: Atp9b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCATCAGAAGGCAAACGCTG, GTATGGAAATAGTAAAGAAC, ATTGCTAACTATGTAGACTT and CATTGATTGTCTATATTCCT, which resulted in a 748 bp deletion beginning at Chromosome 18 position 80,912,310 bp and ending after 80,913,057 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000304562 (exon 3) and 597 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atp9b Mutation: 62 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)