Tns2^em1Nsas
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tns2^em1Nsas
• Name: tensin 2; endonuclease-mediated mutation 1, Nobuya Sasaki
• MGI ID: MGI:6117704
• Synonyms: Tns2^deltaC
• Gene: Tns2 Location: Chr15:102008848-102024836 bp, + strand Genetic Position: Chr15, 57.29 cM
• Alliance: Tns2^em1Nsas page

Mutation origin

• Strain of Origin: (C57BL/6 x DBA/2)F1

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intragenic deletion
• Mutation details: Exon 22 was targeted using an sgRNA (targeting AGAGACAGCCATTCATTCCAAGG) using CRISPR/Cas9 technology resulting in a 5 bp deletion (GRCm39:chr15:102022204_102022208delTTCCA) in the M3 founder line, creating a frame-shift and premature stop codon (p.F1168Rfs*48). Both the C-terminal Src homology (SH2) and phosphotyrosine binding (PTB) domains in the encoded peptide are affected. (J:244469)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tns2 Mutation: 116 strains or lines available

References

• Original: J:244469 Marusugi K, et al., Functional validation of tensin2 SH2-PTB domain by CRISPR/Cas9-mediated genome editing. J Vet Med Sci. 2016 Oct 01;78(9):1413-1420
• All: 2 reference(s)