Atp11c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp11c^em1(IMPC)J
• Name: ATPase, class VI, type 11C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6114795
• Gene: Atp11c Location: ChrX:59268643-59450041 bp, - strand Genetic Position: ChrX, 33.5 cM, cytoband A5
• Alliance: Atp11c^em1(IMPC)J page
• IMPC: Atp11c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAGCTGGTAAATAAGCAG, TATAAGCTGTTCTTATTCCA, TGCCTCAAAAGGATTTCAAA and GCGAATATTACAAATGTTGA, which resulted in a 442 bp deletion beginning at Chromosome X negative strand position 60,295,494 bp and ending after 60,295,053 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283081 (exon 7) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 185 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atp11c Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)