About   Help   FAQ
Slc36a2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc36a2em1(IMPC)J
Name: solute carrier family 36 (proton/amino acid symporter), member 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6114754
Gene: Slc36a2  Location: Chr11:55049296-55075903 bp, - strand  Genetic Position: Chr11, 32.16 cM
Alliance: Slc36a2em1(IMPC)J page
IMPC: Slc36a2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTAGCAGTCAGTGCTTGG, GTAAAGGTAGACTGGGTAAC, CAGCACTTCAATTACCTGCG and AGGATACAGGAAAATCGAGA, which resulted in a 479 bp deletion beginning at Chromosome 11 negative strand position 55,181,761 bp and ending after 55,181,283 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295210 (exon 2) and 388 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc36a2 Mutation:  27 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory