About   Help   FAQ
Ube2iem1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Ube2iem1(IMPC)J
Name: ubiquitin-conjugating enzyme E2I; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6108121
Gene: Ube2i  Location: Chr17:25261916-25274622 bp, - strand  Genetic Position: Chr17, 12.53 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACTCAGAAACTCAATAGCAG and GGGCTTGTGAAAAACACTGT, which resulted in a 954 bp deletion beginning at Chromosome 17 negative strand position 25,269,032 bp and ending after 25,268,079 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000207073 (exon 5) and 844 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ube2i Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/12/2019
MGI 6.13
The Jackson Laboratory