Rex1bd^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rex1bd^em1(IMPC)J
• Name: required for excision 1-B domain containing; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6105940
• Gene: Rex1bd Location: Chr8:70956945-70959402 bp, - strand Genetic Position: Chr8, 34.15 cM, cytoband C1
• Alliance: Rex1bd^em1(IMPC)J page
• IMPC: Rex1bd gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAAAAATAGTAGTAGGTCG, GAGAGGGCCCAAATGCATAG, GGGTGTAGCTTTTAGTAGCA and GTTTGTCTCTTTCGAGTCGG, which resulted in a 554 bp deletion beginning at Chromosome 8 negative strand position 70,506,214 bp and ending after 70,505,661 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291628 (exon 3) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 52 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rex1bd Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)