About   Help   FAQ
Gm4792em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm4792em1(IMPC)J
Name: predicted gene 4792; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6102903
Gene: Gm4792  Location: Chr10:94129527-94134565 bp, - strand  Genetic Position: Chr10, 48.88 cM
Alliance: Gm4792em1(IMPC)J page
IMPC: Gm4792 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTTACAAAGAGCAGGCCAC, GATTGCAGTGGCCTGAAGGC, GCTGCTGAGTCATATGTAGC and GCAGACTCCCATGACCATCA, which resulted in a 456 bp deletion beginning at Chromosome 10 negative strand position 94,295,355 bp and ending after 94,294,900 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000444933 (exon 2) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gm4792 Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory