Gm4792^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm4792^em1(IMPC)J
• Name: predicted gene 4792; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6102903
• Gene: Gm4792 Location: Chr10:94129527-94134565 bp, - strand Genetic Position: Chr10, 48.88 cM
• Alliance: Gm4792^em1(IMPC)J page
• IMPC: Gm4792 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTTACAAAGAGCAGGCCAC, GATTGCAGTGGCCTGAAGGC, GCTGCTGAGTCATATGTAGC and GCAGACTCCCATGACCATCA, which resulted in a 456 bp deletion beginning at Chromosome 10 negative strand position 94,295,355 bp and ending after 94,294,900 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000444933 (exon 2) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gm4792 Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)