About   Help   FAQ
Gm12695em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Gm12695em1(IMPC)J
Name: predicted gene 12695; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6101194
Gene: Gm12695  Location: Chr4:96611884-96673423 bp, - strand  Genetic Position: Chr4, 44.79 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTCATTAGAAAAGTGCAG, TGAGCTGGTCAACATAACTG, ACCACTAATTACATCTCACA and CTCCTCATCATACACAACGC, which resulted in a 580 bp deletion beginning at Chromosome 4 negative strand position 96,769,948 bp and ending after 96,769,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000672016 (exon 2) and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 13 bp insertion (CAAACTCACTGAT) at the deletion site and a 3 bp deletion (TTG) 5 bp after the exon deletion that are not predicted to affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 31 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gm12695 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory