Gm12695em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Gm12695em1(IMPC)J |
Name: |
predicted gene 12695; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6101194 |
Gene: |
Gm12695 Location: Chr4:96611884-96673423 bp, - strand Genetic Position: Chr4, 44.79 cM
|
Alliance: |
Gm12695em1(IMPC)J page
|
IMPC: |
Gm12695 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTCATTAGAAAAGTGCAG, TGAGCTGGTCAACATAACTG, ACCACTAATTACATCTCACA and CTCCTCATCATACACAACGC, which resulted in a 580 bp deletion beginning at Chromosome 4 negative strand position 96,769,948 bp and ending after 96,769,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000672016 (exon 2) and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 13 bp insertion (CAAACTCACTGAT) at the deletion site and a 3 bp deletion (TTG) 5 bp after the exon deletion that are not predicted to affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 31 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|