About   Help   FAQ
Igsf9em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Igsf9em1(IMPC)J
Name: immunoglobulin superfamily, member 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6101173
Gene: Igsf9  Location: Chr1:172481788-172498878 bp, + strand  Genetic Position: Chr1, 79.86 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTGGCCCATGACTACAAA, GAGAAACTGTATGTGCGGGA, CTGAGTTTAATTCAGCGCTG and CCAGTGTTAGGCAGTGACTG, which resulted in a 1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000361352 through ENSMUSE00000366373 (exons 7-9) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Igsf9 Mutation:  5 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
10/15/2019
MGI 6.14
The Jackson Laboratory