Clrn3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clrn3^em1(IMPC)J
• Name: clarin 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6094836
• Gene: Clrn3 Location: Chr7:135113195-135130383 bp, - strand Genetic Position: Chr7, 81.27 cM
• Alliance: Clrn3^em1(IMPC)J page
• IMPC: Clrn3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACCTGGAATGGACTCAG, ATGGGTGTCTATACCTGGAA, CACCAGGTGCAAAGACTTCT and CCAGAAGTCTTTGCACCTGG, which resulted in a 157 bp deletion beginning at Chromosome 7 negative strand position 135,518,605 bp and ending after 135,518,449 bp (GRCm38/mm10). This mutation creates an internal deletion of ENSMUSE00000341796 (exon 2) and is predicted to cause a change of amino acid sequence after residue 84 and a stop 108 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Clrn3 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)