About   Help   FAQ
Krt23em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Krt23em1(IMPC)J
Name: keratin 23; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5927759
Gene: Krt23  Location: Chr11:99368799-99383946 bp, - strand  Genetic Position: Chr11, 62.92 cM, cytoband D
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGGATTATAACTAAAGGG, TATCACGTGCACGTGTACCT, GTTCACGGAATTATTCCAGT and CAGTGGCTCTTGAACATATA, which resulted in a 276 bp deletion beginning at Chromosome 11 positive strand position 99,486,564 bp and ending after 99,486,839 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000112592 (exon 2) and 193 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 132 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Krt23 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/10/2022
MGI 6.19
The Jackson Laboratory