Impg1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Impg1^em1(IMPC)J
• Name: interphotoreceptor matrix proteoglycan 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5927700
• Gene: Impg1 Location: Chr9:80220612-80347534 bp, - strand Genetic Position: Chr9, 43.99 cM
• Alliance: Impg1^em1(IMPC)J page
• IMPC: Impg1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAATATCCTAGGAGCAGCA, CCTTAGTAACCATTTCAAAG, TTAAAGTTAGCCATGCAAAA and ATTAGTGTGTGAACATAAGC, which resulted in a 312 bp deletion beginning at Chromosome 9 negative strand position 80,435,559 bp and ending after 80,435,248 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000694908 (exon 3) and 145 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Impg1 Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)