Hspb9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hspb9^em1(IMPC)J
• Name: heat shock protein, alpha-crystallin-related, B9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5925402
• Gene: Hspb9 Location: Chr11:100604755-100605401 bp, + strand Genetic Position: Chr11, 63.54 cM, cytoband D
• Alliance: Hspb9^em1(IMPC)J page
• IMPC: Hspb9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGCGGGTGCGAAGAGGAA, CGGGGCGGGTGCGAAGAGGA, TCGTTTTGTAAGGAGCTCTT and CCAGTCCCAGAAACCCAGGA, which resulted in a 296 bp deletion beginning at Chromosome 11 positive strand position 100,713,863 bp and ending after 100,714,158 bp (GRCm38/mm10). This mutation generates an internal deletion in ENSMUSE00000891702 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hspb9 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)