Cdk17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdk17^em1(IMPC)J
• Name: cyclin dependent kinase 17; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5912110
• Gene: Cdk17 Location: Chr10:92996492-93086956 bp, + strand Genetic Position: Chr10, 47.89 cM
• Alliance: Cdk17^em1(IMPC)J page
• IMPC: Cdk17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGTCTATGCTCGAGATCCAC, GAGGCACTGTTTACCTTTAA, GCTTGTTTGAAGCATCATGA and TTTTTTCCCTAATTATCCCA, which resulted in a 360 bp deletion beginning at Chromosome 10 positive strand position 93,216,203 bp and ending after 93,216,562 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000574151 (exon 4) and 226 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdk17 Mutation: 63 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)